Find the longest consective run of given substring Python

how to find consecutive repeated characters in a string in python
longest common substring python
longest substring with repeating characters python
longest consecutive sequence python
python substring
longest common subsequence python
python regex
python find all common substrings

Suppose given a string.

str = "AGAGAGATAGATAGATATTAAGATAGAT"

str = "AGAGAGATAGATAGATATTAAGATAGAT"

I have to find the longest consecutive run of 'AGAT' which is three-time. Find the count of each consecutive 'AGAT' and store them and then get the maximum of them in python.

Unless you're dealing with huge amounts of input data I'd go with a regex solution such as:

import re

def longest_run(pattern, input):
    return max(re.findall('((?:' + re.escape(pattern) + ')*)', input), key=len)

This will output:

longest_run("AGAT", "AGAGAGATAGATAGATATTAAGATAGAT") # 'AGATAGATAGAT'
longest_run("AGAT", "AGAGAGAGAGAGAGAGAGAGAGAGAGAG") # ''

Python, Python – Maximum Consecutive Substring Occurrence In this, we extract the substrings repetitions using using findall() and The original string is : geeksgeeks are geeks for all geeksgeeksgeeks The maximum run of Substring : Python | Find longest consecutive letter and digit substring � Python� Given a String (may contain both letters and digits), write a Python program to find the longest consecutive letter and digit substring. Examples: Input : geeks123available Output : ('available', 123) Input : 98apple658pine Output : ('apple', 658)

You could use a regular expression:

>>> import re
>>> str = "AGAGAGATAGATAGATATTAAGATAGAT"
>>> matches = list(re.finditer("((?:AGAT)+)", str))
>>> m = max(matches, key=lambda m: m.end() - m.start())
>>> m.group(1)
'AGATAGATAGAT'

Find the longest consective run of given substring Python, Unless you're dealing with huge amounts of input data I'd go with a regex solution such as: import re def longest_run(pattern, input): return� Given a string, find the longest substring whose characters are contiguous (i.e. they are consecutive letters) but possibly jumbled (i.e. out of order). For example: Input : "owadcbjkl" Output: "adcb" We consider adcb as contiguous as it forms abcd. (This is an interview question.)

import re #Regex
import numpy as np
length = []
agat = []
str = "AGAGAGATAGATAGATATTAAGATAGAT"
pattern = re.compile(r'(AGAT)*')
matches = pattern.finditer(str)
for match in matches:
    length.append(len(match.group(0)))
    agat.append(match.group(0))

print(length)
print(agat)
answer = max(length)/4

The length array is how long a consecutive string of agat is - so there are 2 in the example, one of length 12 and one of length 8, if you divide by 4 which is the length of agat then you'll get the max consecutive agat string.

The agat array holds consecutive agat strings.

Python program to get the longest substring of the same character , Your solution is recreating the longest substring of the given string, then returning the be a reason for you to recreate the substring in order to find its length. i - 1 # Function to return the length of the # longest substring of consecutive but the following code is smaller (in terms of lines of code), and runs� Method 3 (Linear Time): Let us talk about the linear time solution now.This solution uses extra space to store the last indexes of already visited characters. The idea is to scan the string from left to right, keep track of the maximum length Non-Repeating Character Substring seen so far in res.

Python Tutorial: Longest Common Substring Algorithm, Find the longest common substring! Q: Given a string, find the longest substring that contains at most 2 distinct Running Python Programs (os, sys, import) Length of the longest substring with consecutive characters Last Updated: 24-01-2019 Given a string str of lowercase alphabets, the task is to find the length of the longest sub-string of characters in alphabetical order i.e. string “df abc k” will return 3.

Longest Consecutive Sequence, Given an unsorted array of integers, find the length of the longest consecutive elements sequence. Your algorithm should run in O(n) complexity. Example: Given a number n, find length of the longest consecutive 1s in its binary representation. Examples : Input : n = 14 Output : 3 The binary representation of 14 is 1110. Input : n = 222 Output : 4 The binary representation of 222 is 11011110.

Program to Find the Longest Repeating Sequence in a String , Storing the longest string in the variable lrs if the length of x is greater than lrs. Solution. Python. #Checks for the largest common prefix� Given an unsorted array of integers, find the length of the longest consecutive elements sequence. Your algorithm should run in O(n) complexity.Example: Input: [100, 4, 200, 1, 3, 2] Output: 4 Explanation: The longest consecutive elements sequence is [1, 2, 3, 4].

Comments
  • Hey Shahzaib! Welcome to Stack Overflow. In general, this kind of question is considered low-quality (especially since it looks like homework). To improve it, you should share some code that you have attempted and point out specific parts that you find challenging.
  • This is my first question. So I didn't know about the trends. I would definitely try to post further questions according to guidelines.