Regular expression matching a multiline block of text

regex multiline python
multiline regex javascript
regular expression in python for beginners
regex match between two strings multiline python
regex multiline flag
regex capture multiple lines
regex multi-line match until character
regex multiline c#

I'm having a bit of trouble getting a Python regex to work when matching against text that spans multiple lines. The example text is ('\n' is a newline)

some Varying TEXT\n
\n
DSJFKDAFJKDAFJDSAKFJADSFLKDLAFKDSAF\n
[more of the above, ending with a newline]\n
[yep, there is a variable number of lines here]\n
\n
(repeat the above a few hundred times).

I'd like to capture two things: the 'some_Varying_TEXT' part, and all of the lines of uppercase text that comes two lines below it in one capture (i can strip out the newline characters later). I've tried with a few approaches:

re.compile(r"^>(\w+)$$([.$]+)^$", re.MULTILINE) # try to capture both parts
re.compile(r"(^[^>][\w\s]+)$", re.MULTILINE|re.DOTALL) # just textlines

and a lot of variations hereof with no luck. The last one seems to match the lines of text one by one, which is not what I really want. I can catch the first part, no problem, but I can't seem to catch the 4-5 lines of uppercase text. I'd like match.group(1) to be some_Varying_Text and group(2) to be line1+line2+line3+etc until the empty line is encountered.

If anyone's curious, its supposed to be a sequence of aminoacids that make up a protein.

Try this:

re.compile(r"^(.+)\n((?:\n.+)+)", re.MULTILINE)

I think your biggest problem is that you're expecting the ^ and $ anchors to match linefeeds, but they don't. In multiline mode, ^ matches the position immediately following a newline and $ matches the position immediately preceding a newline.

Be aware, too, that a newline can consist of a linefeed (\n), a carriage-return (\r), or a carriage-return+linefeed (\r\n). If you aren't certain that your target text uses only linefeeds, you should use this more inclusive version of the regex:

re.compile(r"^(.+)(?:\n|\r\n?)((?:(?:\n|\r\n?).+)+)", re.MULTILINE)

BTW, you don't want to use the DOTALL modifier here; you're relying on the fact that the dot matches everything except newlines.

3 Advanced Python RegEx Examples (Multi-line, Substitution , 3 Advanced Python RegEx Examples (Multi-line, Substitution, You can also reference the match in the replace string using grouping (we  Regular expression matching a multiline block of text. I'm having a bit of trouble getting a Python regex to work when matching against text that spans multiple lines. The example text is (' ' is a newline)

Pattern Matching On Multiple Lines of Text, Pattern Matching On Multiple Lines of Text. Workflow Pattern Matching and Regular Expressions. Updated December 7, 2017. Subscribe The pattern [^!]+! will match any character except the exclamation mark, followed by the exclamation mark. If the start of the block isn't required in the output, the updated script is: Groups[0] contains the whole matched string, Groups[1] will contain the string match within the parentheses in the regex.

If each file only has one sequence of aminoacids, I wouldn't use regular expressions at all. Just something like this:

def read_amino_acid_sequence(path):
    with open(path) as sequence_file:
        title = sequence_file.readline() # read 1st line
        aminoacid_sequence = sequence_file.read() # read the rest

    # some cleanup, if necessary
    title = title.strip() # remove trailing white spaces and newline
    aminoacid_sequence = aminoacid_sequence.replace(" ","").replace("\n","")
    return title, aminoacid_sequence

Multiline mode of anchors ^ $, flag "m", In the multiline mode they match not only at the beginning and the end of the string, but also at start/end of line. Searching at line start ^. In the example below the text has multiple lines. The pattern /^\d/gm takes a digit The regular expression \d$ finds the last digit in every line. let str = `Winnie: 1 Piglet: 2  In the context of use within languages, regular expressions act on strings, not lines. So you should be able to use the regex normally, assuming that the input string has multiple lines. In this case, the given regex will match the entire string, since "<FooBar>" is present.

find:

^>([^\n\r]+)[\n\r]([A-Z\n\r]+)

\1 = some_varying_text

\2 = lines of all CAPS

Edit (proof that this works):

text = """> some_Varying_TEXT

DSJFKDAFJKDAFJDSAKFJADSFLKDLAFKDSAF
GATACAACATAGGATACA
GGGGGAAAAAAAATTTTTTTTT
CCCCAAAA

> some_Varying_TEXT2

DJASDFHKJFHKSDHF
HHASGDFTERYTERE
GAGAGAGAGAG
PPPPPAAAAAAAAAAAAAAAP
"""

import re

regex = re.compile(r'^>([^\n\r]+)[\n\r]([A-Z\n\r]+)', re.MULTILINE)
matches = [m.groups() for m in regex.finditer(text)]

for m in matches:
    print 'Name: %s\nSequence:%s' % (m[0], m[1])

7.2. re — Regular expression operations, This module provides regular expression matching operations similar to those found in Matches the start of the string, and in MULTILINE mode also matches​  You should be able to match multi-line strings without issue. Just remember to add the right characters in ( for new lines). string pattern = "Start of numbers(.| )*End of numbers"; Match m = Regex.Matches(input, pattern); This is easier if you can think of your string with the hidden characters.

The following is a regular expression matching a multiline block of text:

import re
result = re.findall('(startText)(.+)((?:\n.+)+)(endText)',input)

re — Regular expression operations, This module provides regular expression matching operations similar to those found in Matches the start of the string, and in MULTILINE mode also matches​  Find/Replace: Allow matching across lines ( or multiline regex) or replacement text containing newlines. Find/Replace searches are currently restricted to results that lie within a single line. Few other editors have this restriction (at least for regex searches). There are two reasons we don't support this right now: The CodeMirror search code

Python Regex: re.match(), re.search(), re.findall() with , A regular expression or regex is a special text string used for In multiline the pattern character [^] match the first character of the string and the  But it doesn't work on text that spans multiple lines, like this; [sometag] here is more text it spans more than one line [/sometag] For some reason, Sublime text's regex finder won't recognize the tags across multiple lines. I want to know if this a problem with Sublime Text, a toggleable option, or just my personal incompetence with regexes.

re – Regular Expressions, Regular expressions are text matching patterns described with a formal syntax. This example looks for two literal strings, 'this' and 'that', in a text string. The MULTILINE flag controls how the pattern matching code processes anchoring  I'm adding this because often we're reading data from a file or data-stream where the range of lines we want are not all in memory at once. "Slurping" a file is discouraged if the data could exceed the available memory, something that easily happens in production corporate environments.

About Regular Expressions, A regular expression is a pattern used to match text. It can be A regular expression can be a literal character or a string. you should understand the difference between Singleline and Multiline regular expression options. Substitution using regular expressions; In the first article of this series, we learned the basics of working with regular expressions in Python. 1. Working with Multi-line Strings. There are a couple of scenarios that may arise when you are working with a multi-line string (separated by newline characters – ‘ ’).

Comments
  • Is there something else in the file besides the first line and the uppercase text? I'm not sure why you would use a regex instead of splitting all the text at newline characters and taking the first element as "some_Varying_TEXT".
  • yes, regex are the wrong tool for this.
  • Your sample text doesn't have a leading > character. Should it?
  • You may want to replace the second dot in the regex by [A-Z] if you don't want this regular expression to match just about any text file with an empty second line. ;-)
  • My impression is that the target files will conform to a definite (and repeating) pattern of empty vs. non-empty lines, so it shouldn't be necessary to specify [A-Z], but it probably won't hurt, either.
  • This solution worked beautifully. As an aside, I apologize, since I obviously didn't clarify the situation enough (and also for the lateness of this reply). Thanks for your help!
  • match() only returns one match, at the very beginning of the target text, but the OP said there would be hundreds of matches per file. I think you would want finditer() instead.
  • Definitively the easiest way if there was only one, and its also workable with more, if some more logic is added. There's about 885 proteins in this specific dataset though, and I felt that a regex should be able to handle this.
  • Unfortunately, this regular expression will also match groups of capital letters separated by empty lines. It might not be a big deal though.
  • Looks like coonj likes FASTA files. ;)